EST 1792613 is a singleton


Sequence

>1792613 (1 EST) Length=322 TAAGCCCAAAAGGATGGAGAAAAACAACAACAACAAAAAAAAAAACAATTGTGAGCTCAATACCCCNGTTGTCGCTTGAC GGCCGCTACACGTTCTCGGTCAATACGATGCCTCGCCTCAAGTTCCTTCAGGCGCTGTTCGCGACGCCATGCTGCCTCAT CTTGCTGTGAGCGCCATTGTGGGGTGCAAGACTCCAAGGTTGAAATGCTATTCTCGTCACGCGGCTTGCGTGAAGCAGGC AGTTCTGGTCGCGGGAGATTTCGGGCGTAGTCCAGGGCACGTGACCTTCGGTCTTTTGCCTGAATGCGTTCTGGGGGAGG TG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1792613: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17926133320949AI053322TENU1482T. cruzi epimastigote normalized cDNA Library


Date: 16:28:28 on Sun 19 Nov 117.