EST 1792614 is a singleton


Sequence

>1792614 (1 EST) Length=333 TGCATCATGTTCTTTGCATCGAACATCTGCTGCGTCANTCTGGCACGGACAGACCTCGGTACTGCTGCGAGCCGCGGCTC GTGAGCGGGGCAAAGCCATCATGAAGAAGTGCAGACGAGGGAACGGCACCAGGTTCACCGCCAGCTTGCGCAGGTCGGAG TCCTGGTACTGCTGGTACTCCGACACAAGATCGTTCATGTTGGACTCCGCCTCGGTGAACTCCATCTCGTCCATGCCCTC GCCCGTGTACCAGTGCAAGAACGCCTTGCGGCGGCGTTATTACTATTGCTATTTTGTATTGGTGTAAAATTTTGGGAGAA TGGGGCGGAAGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1792614: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17926143320950AI053323TENU1483T. cruzi epimastigote normalized cDNA Library


Date: 13:48:8 on Thu 23 Nov 117.