EST 1792616 is a singleton


Sequence

>1792616 (1 EST) Length=427 TACCAAGGCAGAAAAGCAAATAAATTACTCAGTCACACTCTCTTGTGCACGCGGCCTTCCCTACACACCCAAAAGGATGC CCCAAAAATCAACTTACCTTGCAATTGTGCAACGATAGGGGAGAGGTGGAAAAAGGTGATGGTGTGGGGAAGCAGCCAAA CCGATGATTTTCAAAGGAAAACCCGTTTTTNTTTTTTTGAGGATTTCACTCACACTCTCGGTTCATTGCAATTCCGCGTC GTCCAAGCAATGCAAAAGTTTTATGGCCGCCTCCCGGCAATGCGGCTCCGATCCCGCTTTTAATGCTCGCAACGTGTGAG CAAGTGTATTGCGCCCCACTTCCACCGCAACGACAGAGGTCTGAATATCTTTGCCGCTGCCGTCAGAAAGCATGAGCGTC ATGACCGTCGCCACAAGGTCTCGCGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1792616: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17926163320952AI053325TENU1485T. cruzi epimastigote normalized cDNA Library


Date: 0:37:37 on Fri 24 Nov 117.