EST 1792632 is a singleton


Sequence

>1792632 (1 EST) Length=315 AAAAAATACGGCTTCTATCGTGTCGGTTTTCTTTTTGTTCCTATTTTNAGTTTTCTTACTGCCTTCAAGGCGGGGTGAAG CGGGAAATGAGGCTCTATCCATCCGCGGTTGTAATTCCTTCTGGCCGCGTGGGCGAATGTGCTTTACAGACGCGCAGGCC TGAGCCATACGTTCAAATGGCCACTTGGGATCACTTACAAAGACTTCTTGCTTGAACATTGTTGTGGGCCGGACCTTCCA TTGGCTCCGTCCCTGGAAGACCAAACGTTTGGCTCCCCGTCGTCCTTTATTGGGCCCCGCGTGGTAGTCTTGGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1792632: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17926323320968AI053341TENU1503T. cruzi epimastigote normalized cDNA Library


Date: 10:34:45 on Sat 18 Nov 117.