EST 1792642 is a singleton


Sequence

>1792642 (1 EST) Length=214 GCCTATTTGCCCCCATAATATAAACACGCCGAGGCGGTGAAAAAAGGACGGCAAAATTCAGTGAATGACGTGAAAAAAAG ACCGGCCGGACGAAAAATAAAAAAATAAAAAAATAAAAAAACGGCCCACGCCCTCCGGTCCAAAAAATACCGCCACCACC GTCCGTGAAAACACCAAACACAACAATTTTTATCAATTCCGTTATTGTTTTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1792642: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17926423320978AI053351TENU1513T. cruzi epimastigote normalized cDNA Library


Date: 12:1:13 on Wed 22 Nov 117.