EST 1792655 is a singleton


Sequence

>1792655 (1 EST) Length=309 TGTGGTACAACGCAATAAAAACGGTTGAGAGAGGCAGAAAAGCCAACAAAACGCCAATAAACAACAAGGGATAAGCAGAG AGAAGATAAAACGCCTAAACCGCCCACCTTCCCTCACTGCTCTCAGCCTCTCGCCCAGACGCGAATGCCACATGCAGGCA GCCAACAATTGATCCAACACAGCATGAAAAAAGAAAAAAAAAGTACAAGCATCACAATGCCGACGGAGGAAAAAATATTC AAAGTCGGGTTCCTCAATTTCAAAAGATGTAGGGAAGCAAATGGAGTGATGACAGAAAACAAACCCAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1792655: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17926553320991AI053364TENU1528T. cruzi epimastigote normalized cDNA Library


Date: 11:14:22 on Sun 19 Nov 117.