EST 1792662 is a singleton


Sequence

>1792662 (1 EST) Length=344 AGGGTCCGGTATAACTCCCAAAATTAAAAGAGAAAAATGAAGTAAAAATTGATTTGGCGGGACTTTTATTTCATGGACTG AGCATCACAATACGACCAACCGTGTGATCGCGTATATACATATTGCCCGCACCAACAAAAAAGAAGCGGAATTAAAATAA ATAANAGAGATCCTACTCTTCCACCAGCCCACACAACACCCTTCACACGTCATGCGGCATCCGGCCTGTTCCTCCAATCC TCCTTTCGTGCAGTCCGTGGGACGTACAGCCGCAGGCCGGAAACGCGTGTGGGCAGCAAATGAAAACAAAAGGGGGAAAC ACGTCACACATGGCGGTGTGCGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1792662: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17926623320998AI053371TENU1535T. cruzi epimastigote normalized cDNA Library


Date: 13:49:1 on Mon 20 Nov 117.