EST 1792664 is a singleton


Sequence

>1792664 (1 EST) Length=222 TCACGTGGCCGCGCGTTTCATTCGCATCTTCGTCAGCAGCAATTCTATCGGGGAAACCCCGCGGAAGATGACTGCTGTTC GTTCCCCTCGTTTGTGCTGCGTTTCCCTCCCGTCAAACGTGACGGGGGTTCCTTCCATCAGCAAATTTCCCCGCACCCTC TCCAGGTGCTCGGTGCCATCCTCCGACCAGTCCAGGCTGTGCTCCCACTCGTATCGTGCGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1792664: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17926643321000AI053373TENU1538T. cruzi epimastigote normalized cDNA Library


Date: 6:15:39 on Wed 22 Nov 117.