EST 1792668 is a singleton


Sequence

>1792668 (1 EST) Length=222 GGCAAAGTCANGTGAAAATAAAATAAAATACCATTCGGTGGTGTTTCCCAGCACGTGTCTCTCCTTAGTTCAGACACTTT TACGCAAGAGCTAAGATGCTCACTTCTTTGCTTTCTTTGGGGCGGCGGCAACAGCAATACCCTTGGCCTTGCGCTCCGCA GCGGAGCCACGCGCTCCTTTCGGAGCGGCTCCTCGCGACGAATGCGGTCCTTCTTGAGCGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1792668: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17926683321004AI053377TENU1542T. cruzi epimastigote normalized cDNA Library


Date: 23:12:53 on Mon 20 Nov 117.