EST 1792669 is a singleton


Sequence

>1792669 (1 EST) Length=194 TAATCAAACACAAGTACTAAGTGCGCTTTTCCTATTACAGCGAAACTTCATTAACTGTTTGACAGGAACCGGACTCAAAC CTCACAGTTGACACTTCCATACCAACCTGCAATGCATTGATGCTACTACATTCTCCACAGCGAACCTGAAGTGGCCGTGT GGAAGCGGGAGGCAATTGGGGATGTTGAGTCTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1792669: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17926693321005AI053378TENU1543T. cruzi epimastigote normalized cDNA Library


Date: 21:59:14 on Sat 18 Nov 117.