EST 1792672 is a singleton


Sequence

>1792672 (1 EST) Length=205 TATTCCTCGTAGGTGAGGATTTGCTTGCCCCCTTCCCTTCAATACACTATGCACTCTCTGTGTGAATGGTTAAAAAATAT TTATTATACCAAAATAAATCGCGTTGGAAGGCCTCCTTACCCTCTTCTTCTTGCCGTGTGTCTGTGTANGTATGTGTGCT TTCTGTATGTATGCCGTGGCCCTGAAAACAAAAAGACAGGAAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1792672: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17926723321008AI053381TENU1546T. cruzi epimastigote normalized cDNA Library


Date: 0:24:8 on Thu 23 Nov 117.