EST 1792677 is a singleton


Sequence

>1792677 (1 EST) Length=175 TCTGTACAGATGAGATGTACTCACGTTCCTTCTCTCTGCTTCCCCCCAGGCGTACGTCGCCGAAAGCGCCGACTCAAACG GGCTTCGGTCTCCGTCGCCGCAGCGCACACATCGGCAGTCAAAAAAGTACCGCTCGGCGAGTTCCTCGCGTCGCAGCCAC GCCGGCCAGTACAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1792677: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17926773321013AI053386TENU1551T. cruzi epimastigote normalized cDNA Library


Date: 22:50:58 on Wed 22 Nov 117.