EST 1792703 is a singleton


Sequence

>1792703 (1 EST) Length=163 CCTCTCCAGGCGACTGCACTCCGCAGCAATTGCCTCTTCCATTGCACACTCCTCCGCAGAGGTGGTGTACAGCTGGTGCG AGTGACATTCAACAACGTCTTCGATGGCGCGGATGTAGGCGGCGTATTGCACGGCCTCCTTGTCATGAAGGATACGCTGT TGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1792703: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927033321039AI053160TENU1580T. cruzi epimastigote normalized cDNA Library


Date: 9:21:32 on Sun 19 Nov 117.