EST 1792708 is a singleton


Sequence

>1792708 (1 EST) Length=378 TGCTGTCCGTGTCCCGCCGGTGTTGCGACATGTATTCCGCATGCCATGCCGGAATGAAGCCTGTCGTCCATTGGTCAATA TCCACGGTTGGGTTTAAAATGGCGCTACGATTTCTTCATGCGCGAGGATCAAGTAACTTTTTAACTCTGAAAGAAAGTTG CATTCAGGCCGTCTCGCCCTTTCAATGAACTCCATAAAGCTGAGGTTCCCTTGAAGAGCCTCAATGGCTTGAGCCACTTG ATCCTCCACAAATCGTCGCCGATTCTCCCGCTGCGTGCGCCGCGCCTCTCCCTCTGGTTGCTCTCCCCATTGCCTCACCG CTTCTACGAGGCGCTCCCGGGAAGCTGCAAAAAAAGAAAAATCTCCCTGAAGAAGTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1792708: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927083321044AI053165TENU1585T. cruzi epimastigote normalized cDNA Library


Date: 23:53:34 on Fri 17 Nov 117.