EST 1792711 is a singleton


Sequence

>1792711 (1 EST) Length=255 CAAACACAGAGGGGTGGAAGCAGACTGTCTCACAGCAGATCTTTTGAGAAGACGGACTCTTTCAGCGAGATGGCCTTCTG AATGATGCTACCGGCTTCAATGCGCGGGAGGTGTCGCAACCGCTCAATGATGCCGGACTTCTCACACTCCAGCAACACTT CCGTCATCTCCTCGAGAATAGCCAGACAGACGTATGGATGCAGCGGAAAACCCAGGTACTCCAGGGCATCCGCCAAATAT ACATCCCACAGGCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1792711: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927113321047AI053168TENU1588T. cruzi epimastigote normalized cDNA Library


Date: 13:43:39 on Thu 23 Nov 117.