EST 1792712 is a singleton


Sequence

>1792712 (1 EST) Length=324 TCACAAAGACACTAAATATGTGAAATCACATCAGAAGANTTAGTCTCATGCGTTTAACGAAGGAAATACATGCGCACACG TAAGCCCTAACGCACAAGGCCATAAACACGGAAACTGGTTTTCAAAATCAAAACAACATAATAATCAAAAAAAAAAAAGA AAAGGAATCTTCCTTTTAACTTTACATTGCGAGAACCTAGTGAAATTTACGGAACATATAACTACATCGCGGTCGATTTA ATTACATTCTGGGCAAACGCCGAGGCCTGCAAGACAGACTTTCTCTTCTTCTCATTTTCCAACGCTTTCCTTTCCTGCTG TTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1792712: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927123321048AI053169TENU1589T. cruzi epimastigote normalized cDNA Library


Date: 17:12:38 on Fri 24 Nov 117.