EST 1792716 is a singleton


Sequence

>1792716 (1 EST) Length=295 ACACACGCAGCGCGAGAACACACGCATTCACGCAGGCAGAAAGCGGCAGTAAGAGGGATTTCATCAGCCAAAAAAAACAA CAACAAACAACAACAACCGCAAGCGTCCATGCGCCGCCCGCAAGCTGAAGGTGGATGAATGAATCGTATGCCCAAGCAGA GGCACTGAAGGCGGTAGAGGGAAAAAAGAACGATCAGTCACCATAAAAACAAAAAAAACTTCGCCGACACACAGGCCAAC AAAGGCTCATGTGCCGTACTCGTCAATATCGGCGTTCAACGCATACAAAAAACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1792716: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927163321052AI053173TENU1593T. cruzi epimastigote normalized cDNA Library


Date: 2:38:18 on Wed 22 Nov 117.