EST 1792718 is a singleton


Sequence

>1792718 (1 EST) Length=182 CGTTACTCTGCCCCCTCACCCTCTCCGTTCCCGGTACCAAAAGATGTGAGGTAAAAGAGAGAGAGAGAGAGGGAGAGGGA GAGGGAGAGGGAGAGTAAGAGGGCCCCTTAAACTAATTGATTAGCTCCTCTACAAACTGATGATAAATAACGCACATGTT TGCGGCAGACTTCACTTTAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1792718: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927183321054AI053175TENU1595T. cruzi epimastigote normalized cDNA Library


Date: 5:58:56 on Thu 23 Nov 117.