EST 1792719 is a singleton


Sequence

>1792719 (1 EST) Length=172 CGGGCGCAGTTATTAATACGGGCGTGTGTGTGTTGTGTGGATGCCTCCACTCAAGAAATATGTTGAAAGGAAAAAAGAGG AAAAAAAAAAAAAGAATGAAAGAAAGAAAGAAAGAGAAAAAAGAGAAAACAAACAAAAACAGAAAAATGAACATAAACAA AAAGAAAGAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1792719: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927193321055AI053176TENU1596T. cruzi epimastigote normalized cDNA Library


Date: 21:24:19 on Sun 19 Nov 117.