EST 1792720 is a singleton


Sequence

>1792720 (1 EST) Length=275 AAATCGTTCAATAAAACATACCATCCAAACAAAAACGCGGTATTCCATTCCTCTCATAACTTTTCCTTCTCTTAAAANCA GAGAAAGCCACCCCTTCCTCAATATACGTCGACTGACATTGACAAAATACAACACCCATATCATTCCCAAACATTCTCAA TTTGTGTGAGAGTCAAGGTCACCGACACTCTCAATGTTTCTCTTGCGGACGGGTATGACACCCTCCTCGTTCTCAGCGCC TTCTTGAAAAGAGTAACTTGGAACAGGGAAGCGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1792720: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927203321056AI053177TENU1598T. cruzi epimastigote normalized cDNA Library


Date: 9:46:44 on Fri 24 Nov 117.