EST 1792723 is a singleton


Sequence

>1792723 (1 EST) Length=193 AACATCAGAAGTATAAAGAGTGACAGGCATGCCCTCCCACACAGTAATCGTGGAACAGGAGATAAATTCACTGCAGGTAC CCGCACAAAAAATAGAAACAAACCAACAAAAACCAACAATCAATGACGCTGTCGCTGCGGAGTCCGATGGGTGGCTGTGC AGCTGCACAGCGTGGCCCCCACGCCCTCCCTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1792723: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927233321059AI053180TENU1601T. cruzi epimastigote normalized cDNA Library


Date: 6:15:26 on Thu 23 Nov 117.