EST 1792725 is a singleton


Sequence

>1792725 (1 EST) Length=169 AAAAACAAACAAACGAACACACACACAGGCAACAAAACAATAAGAATAAAAACGAAACACCAACGACGACAAAGAAAAAG ACACCAGAGTAAGACAAAAGCAGCAAAAGGAATTCCACGACAAGGTATCCCTGACGATGCAAAAAACTCACAAGTCAGAT TTGCCCCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1792725: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927253321061AI053182TENU1603T. cruzi epimastigote normalized cDNA Library


Date: 19:49:26 on Fri 17 Nov 117.