EST 1792729 is a singleton


Sequence

>1792729 (1 EST) Length=325 GCTGAGGTGGATGCTGCGCTTGAGGAGCTGATGGGCCTCAGGGTCAACGACAGTCTGGTGCAATACCTTTCGTATTGTTA CGTCCCACCTCACCGCGTGGTGCTTGTGATGCAGTACGTCCCTGGTGGGACTCTGCGTGAAATGAAATCCCGGTACGGAC GCAAGCTGCCGCTGACTGCCGTGACGGAACGTCGCGTCGATGCTGCGGGGCCTGGCGCACCTGCATGGGCGCGGTGTGAT CCACGGACGTTTGTGCCCCGAGAATGTGATGGTTGGTGTGGAGGGGCGGTGGCGGCTCAAGGGCATGCTGCTGGGTGCCG CGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1792729: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927293321065AI053186TENU1607T. cruzi epimastigote normalized cDNA Library


Date: 9:11:25 on Sat 18 Nov 117.