EST 1792738 is a singleton


Sequence

>1792738 (1 EST) Length=262 AAAGGGTAGAAAGAAGCCTGCGACTGCCACGAGCCGATCGTAGAAAGAAGAAAAAACGTATGCACTCTGAATCAACTGCA GAATCTCCATCTTTACGGCAATGAGCGGCATCAAAATCTTCGTTTCACCCAATCCGGGTGCGCACATATAACTCCTGCAG ATCCTCCGGATTAAAGTTCAACAGTGTGCTAAGAACTGGCAATAGATTTCTCCCCACATCACCGCATTCAGCGGCCCCAA GAATTTCACAACTGCACTTCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1792738: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927383321074AI053195TENU1619T. cruzi epimastigote normalized cDNA Library


Date: 11:38:18 on Fri 24 Nov 117.