EST 1792741 is a singleton


Sequence

>1792741 (1 EST) Length=190 GGGAGGGGAAGTCACCTCTCTTAAGAGGCTTCTGTACAGCATCATGCTCTCGTGTAGTTTCGAAAAGGCGGCTTTCAAGA GTAGACCTGAAGGGGTGCTGTGGCTCCATGAGCGTAAACAAGGAGCGTAGGGTGGAAATATCCCGCATCGTCCTCGTATT TTTCACCGCCACCTCCGGCATGTCGGCACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1792741: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927413321077AI053198TENU1622T. cruzi epimastigote normalized cDNA Library


Date: 23:24:38 on Sun 19 Nov 117.