EST 1792753 is a singleton


Sequence

>1792753 (1 EST) Length=196 CGGTGGACCCTCACGGCATTCCACTAAACACGGTGGTCGGCGGTCATGCGCAGGACCCACAGGCAAAAAACTAAGAAGAA AAAAAGAAGTTGTTGGGCTGGCGGGAGGTTTGCCCCCCCGTATTGGACCTCTTGTGCAGGATGTTGCTGTTGCTTTGCGT CCCCGCGTTGTTGTGTGTTATTTGACGGTGCTCCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1792753: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927533321089AI053210TENU1635T. cruzi epimastigote normalized cDNA Library


Date: 6:50:28 on Sat 25 Nov 117.