EST 1792759 is a singleton


Sequence

>1792759 (1 EST) Length=411 CGCAACTCCGAGTGCCCCGCAAGGTCCAAGTCCTCAAGACCGACAGTGAAACGAGGGGGCATCCTCATTTAGACGACCGC TGAGGTCCAATTCCGCAATGACACCTTTGCCTGCAAGCTGATCCCAGCTCTCAACGTAGCCAACGAGCATTATGGGTGTC ACGGGCTTCTCTTTACCGCCACGAGCATCGTACAGACGAATGCGGTGAGCAAAAGTGAGCTTCTTTGACTGCTCGCCATC CACCTCCTCGTCGGTACCGTCTGTGCGTGGCGGTGTTGAGGAGGCAGAGGCAGCGGAAGAAGAAATGTTCGCCTCTGCAA GGCGCGCATTTAGATTTTTGCTTTGCTCCGGCAACCGGACATCAAACGCGACAGTCTGTCCTTCCGCCACATAAAACCCG CCGTCAAGTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1792759: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927593321095AI053216TENU1641T. cruzi epimastigote normalized cDNA Library


Date: 3:52:15 on Sun 19 Nov 117.