EST 1792768 is a singleton


Sequence

>1792768 (1 EST) Length=230 TCCTATATATTACAGTGCAGCGCACGTAAAGCAGTTTGAAATAAAAATAATTATTATTATATTAAAAAACAAAAAACAAC AAAAACAACAACAAAAAAAACAACAACAAAAAAAAAAAAAAAACGTAAGAACCGCCAATTTTCCGATGCTTCACTTGTTT TCCTCATTTTGCTCAAAAGCGTTGAATGCCGATGCATGTGTGCCTTATTTGCCTCGTGGCAATTCCACGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1792768: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927683321104AI053225TENU1650T. cruzi epimastigote normalized cDNA Library


Date: 13:22:34 on Thu 23 Nov 117.