EST 1792769 is a singleton


Sequence

>1792769 (1 EST) Length=264 CCCCCCTCCTTTCTCGGCCCGTTGGACTCATTCCCATCATTACAAGTGGCGTGAGACGGCTGCCGCAACACCACAACCAA CACCAACAACAGCAAGATTGTCAGAGAGAAGATGACACCACCCCGTTCATGTGTATTTCTGTGTGTCTGTACAAAGGAGC TGAGGATCGAAAAGCGACTACCGCGCGCGGAAGGTTTTAACGCGCGGGTCCCTTGCACCGACACCCTCAAAGCCATGAAA GCGTGGCACAACATCGCTTTCACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1792769: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927693321105AI053226TENU1651T. cruzi epimastigote normalized cDNA Library


Date: 3:3:41 on Tue 21 Nov 117.