EST 1792771 is a singleton


Sequence

>1792771 (1 EST) Length=369 CGACTTCACTTTTGGTGAGAGACGAGCAGATGGCGCCCTGTACGCCTGGCGGAANGCGGTAACCTGCAACTGTACCAAAT GGGCGGAAAGCCTGAAACATTTGTCTGTTACCGTTGTGGCTACCCGGTGCGCACCAACTCGTGGCGATAAAAGGGGACAA CTGGGATTACCGAATGTGCTACAAGTGTTACACGACAACTGTACACCACGGGATGGAGAACGATACATGAAGGTCTGCGT GTGGGTCTGTGTTTGTGAAACGGAAAAGAGAGGAGTTTTGCGTCCAGCAATATATGCGTCTTCTCTTTGGGAGCGGCGGG TGGTCCCTGTAGTGTTGTTGTTGTTGGTGGTGGTGGTGGTGAGGTTGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1792771: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927713321107AI053228TENU1653T. cruzi epimastigote normalized cDNA Library


Date: 2:34:9 on Sat 25 Nov 117.