EST 1792773 is a singleton


Sequence

>1792773 (1 EST) Length=154 TCATGCACAATAGACATGAAAACACAAGAGAAGAAAAAAATGAAATAAAATAAAAGAATATATATTGCAGCTTCATTTCC CACAGAAAATCCCAAAAGAAAAGCAAGCAGGCTGAAATGGGTGCATGGGTGTGTAAATGCAAGGAAACATAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1792773: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927733321109AI053230TENU1655T. cruzi epimastigote normalized cDNA Library


Date: 14:50:31 on Sun 19 Nov 117.