EST 1792785 is a singleton


Sequence

>1792785 (1 EST) Length=346 TGTGACCATTTTACTCGGGAGATGAAACCATTACTACGATCAGTACTCCCATCCCGAAGCTACATGCGTGCATCACGGCA CTGTATATCTCGTAGCTGTATCTGCAAAGTCAGACATGCATGGGAGATAGGATAGGTGCGTATTTCTTTGTGCGTGACCA TTAAGCAATTAGAAGAAAGAGACGAAGAAGAGAAGCAGATAGAACTCCGTTAGAAAAGTGAAAAACCACCTTTTAAGCAG GACTAATCCTTATCCACTACGTTCTTAAACCGTAACATAACCGAAAAGTCATTCGGGTAGCACGTTCCTTTTGCGTCTCT GTGAGGTCCGTCCAACTGTAACTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1792785: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927853321121AI053242TENU1667T. cruzi epimastigote normalized cDNA Library


Date: 7:12:16 on Mon 20 Nov 117.