EST 1792795 is a singleton


Sequence

>1792795 (1 EST) Length=163 AGTCCCCCACACTGTCGGTTACCACATCGCCCAGAAGAAAAAAAAAAGGAAAAAAAAAGCTAAACATATGTGTCCTCCTC CTTTTCGCCCTCCCTCTGCCTTAAGAACCGCCACAGTCTTTGACGTCGACTCGCAAAAGCATCCAAACAAATGGGAGGGA TAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1792795: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927953321131AI053252TENU1678T. cruzi epimastigote normalized cDNA Library


Date: 20:10:16 on Sat 18 Nov 117.