EST 1792803 is a singleton


Sequence

>1792803 (1 EST) Length=338 TCATATTTGTAAAAAATAAAAAATAAAATAGTAAACAGTAACAGTGGCAACAATAATAATAATAATAATAATAACTGGTT ATGCAAACAGCTTCTTTCCCCGCAGAATACTTTCACTTACTCACACACACACACACACACAGAGAGAGAGAGAGAGAGGG AGACACTTACTTATTCAATACACACATGCGAGAGAGGTGTGTTTATAAATATAATATGGCGCAGAGACAACAACAACACA AACACAACACATATACCCCACACGACGCACACACACACACGCGGTCCCCCCATGCACACACAGCGCGGTACAAACACACA ACACATATATATATTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1792803: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17928033321139AI053260TENU1688T. cruzi epimastigote normalized cDNA Library


Date: 23:35:27 on Sun 19 Nov 117.