EST 1792809 is a singleton


Sequence

>1792809 (1 EST) Length=219 CGTTTGCGGGCCCTCTCACTGAGAGATCGACCGGGGAGGGGCAATGGGATGGGATATATCACGGCGGAGGGCGCGCTGCC GTCCATCAGAATATAGGCAAAGGTGTCGCATGAGATGATACATTTCCCCGTCACCACCAGCCAGCAAGCTCTCAGAAAAG AAAGGGAATATTTCCCAGTAGTGGTCAGGCGGCACAAAAAAACCCAACCGCGCAACAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1792809: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17928093321145AI053266TENU1694T. cruzi epimastigote normalized cDNA Library


Date: 18:34:29 on Sat 18 Nov 117.