EST 1792810 is a singleton


Sequence

>1792810 (1 EST) Length=451 TGGCACACACCCGTCCAAATGCCGCGGGATATCAATGGCTTTCAGTGCGCTCTCCCACGGGCAAGTCCGCCGTTGGTGCA ATGAAAGATCGTGCTCCACAACGGTGCAACCCACGGTCTTCTTTTATTGCGCATACGCGACCATACGCCTACTGCTCAGT GGGTTTTGTCTCATCAAACGCACAATCAGATGTATAATCAAAATCACACAAAAATAACAGGCACAACAAAGCATAATCCC AAGAACACTGTCAGTACAACAGGATTAGAAATTAAACGGGGAATGCGGCACACAGCCCGGGAAAGCACACTCCGGCACGA CAGAGGAGGCGAGGTGGTGCACCGTGGCGCAGAGAGACAGAGAGGGAGAAAGCGGCGGAGAGGGCTGTGGAGGGAAGGGG CGCGTCAGTCCCGTGCCTGTTGTAGGTAGCTGGGTGCACGGAGGTGTAACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1792810: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17928103321146AI053267TENU1695T. cruzi epimastigote normalized cDNA Library


Date: 20:56:58 on Sun 19 Nov 117.