EST 1792811 is a singleton


Sequence

>1792811 (1 EST) Length=199 TCCTGCTTTCCGCGCAGTTGTCGCTTTACTCTATTCGCCTTCGGAATACAAGATGATGGTGGTGCGCCATACTCCACTGC TGGATGGGCCTTGCTGCGCTTCCACTCGTGTCCGCCCCCAGAAAGAGGGAATACACGCGCACGCACCATCACCTCCTCCT CCTCCTCCTTCTACGCACACAGTGGCATCGTTAATCCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1792811: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17928113321147AI053268TENU1696T. cruzi epimastigote normalized cDNA Library


Date: 12:50:6 on Fri 17 Nov 117.