EST 1792815 is a singleton


Sequence

>1792815 (1 EST) Length=355 CACCGTTGCCTCCCTCCTTCCCTAAATATTTCTCTTCTCAGCGTGTGGGTGCTTGCGTAGACGCCATGAATTCCTGCATG GCGGACTCACCAAGAGACCTCACCATCTGAGCAAACCGTGTGTCTGCAGAGCGCACAAGATCATACGGCGACCCCATCTC CACCACACGGCCTTCCTCCATCATCAGAATCACGTCGTACGTGGCGAGCGTGTGCAGGCGGTGGGCAATTGTAATGACAG TGTGCCCCGCAAAGACATGGGTGACGACATGTTGAATCTGTTTGTCAAGCGTGGGGTCAACATTGGCGGTACGTCATCCA TCAGAATAAAACTGCAACCCCGCCGCAGTAGGGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1792815: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17928153321151AI053272TENU1701T. cruzi epimastigote normalized cDNA Library


Date: 0:16:39 on Fri 24 Nov 117.