EST 1792816 is a singleton


Sequence

>1792816 (1 EST) Length=209 TCCATCTGTTAAGTTCCGCTTTTAAACGTTATCATCGCGGCATCGATTGCTTGCGGGTCGTATCTGCCCACCCACCCCTC GACATCCCCCATCTTCTTCTTGTGCCTTGCCTTTTTGTTGTTTGCTTATTTTTCAGTAGGATCACACAGCCACACCAAAG TGTACATGTATAATGGATATCACAGGCAACACCAACAACAACAGAAGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1792816: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17928163321152AI053273TENU1702T. cruzi epimastigote normalized cDNA Library


Date: 12:12:50 on Fri 17 Nov 117.