EST 1792820 is a singleton


Sequence

>1792820 (1 EST) Length=496 TGGGGTCTTTTCCTTTCATTTAGTTTCCATTGATGTTCTTCTTCTTTTTGTTGTTCTTGTTTGCCTTCTCCTCTCTTATT TTTCTTTCCCCACCTCCTTCAAAGCACTACTCACAACTCTTCTCATACCTGCAGCCGCCTTGTCCACCCCCCTTCTATTC GTTTTTTTTTCTGATACTACCACCACCCCCTCCCATGACGCCACCGCGTGTTGCCGTGTCTCCTCTCCCCCATGCTGCTC CCTCATCGTGTTTGTCATTTGCGTGTTTGAGCGCGGAAAAATACCATAAAAGCGTTTCGTCCTGCTGCGGCGCTATGAGA TGAAAGACAGTCCAACGGAGGGGGGAAGCCACCACCACCGCCACACAGACACGGAGACAGGAAAATGGAGAAAGAACGAC GTATATATTATATACATATATGTATGTAGCAATACATATGTGTGTGTGTATGTGGGAAGGAGGGATTTAGTAGTTGTGAG CGGGGCACAAAAACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1792820: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17928203321156AI053277TENU1706T. cruzi epimastigote normalized cDNA Library


Date: 17:49:52 on Mon 20 Nov 117.