EST 1792831 is a singleton


Sequence

>1792831 (1 EST) Length=357 TGCAGATGTTTGACATCTTATTCTCGGGTTTCGTTTATTATCCTCCTTTCCCTTCTTTTTTGTTTTTGTTTTTTCTTCTG TTTAATTTTAATTTTAATTTTAGTTTGTATTCTTTTTTTTTGTTTGTTTGTTTGTGTGTGTGCGTGTGCGTGTTTTTGTC TCCCGTTTGTCTGTCTGTCTTTCCGTGGGCCAAAATGAGATGAAATATGCGTTGCGGTTTGTGATGTTTGTAGACGTGTG GACGGGGGTGCCGCGTGTGGGCGCCCTCATGTGTCTGTACGATACGACGTCGATTTTGTTGTTGTTGTGAAATGCAAGCA GACATGAGTATTGCATCTCTTCTTAATCCTACCGGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1792831: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17928313321167AI053288TENU1717T. cruzi epimastigote normalized cDNA Library


Date: 20:56:49 on Wed 22 Nov 117.