EST 1792833 is a singleton


Sequence

>1792833 (1 EST) Length=300 AGCACAGTTGGGGTGGTGCGTGGGGGCGACAGAAATAAAAAACTAAGAAAAAAGTAAAAAAAAAAAAAAGAACGGAGGAG GAAAACACAAAACAGGCAGAATGTAAAATGCACGTTACAATGGCTCTACCGCACCTGCCAAAATAAATCATCGTCATCAT CTGGGCGGCGCCGTGGGCGGTGGCGAGAAAACTTCTTCGTACATCCCCCCACGGGCATAACTCCACTCCGTTTCATTATT CGTATCCCTCCTGCTAACATCAACGGAAGGCTCATCTGCCGTCTGCCGCGCGTTGTGCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1792833: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17928333321169AI053290TENU1719T. cruzi epimastigote normalized cDNA Library


Date: 11:55:14 on Fri 24 Nov 117.