EST 1792834 is a singleton


Sequence

>1792834 (1 EST) Length=435 TGTTTGGAGCAGAAATTTTTTATTGCTTAAGAATTGTTAAACTTTGGGATCTTCCAACAACACGACGCCGCCGCGAGCGA AATCAAAAGAGGGTGCGAGGGATAACAACAACAAAAACAAAGAATTTCGTCTTGCCGTTATCGGTTCCCTGCTTCCCAGA ATCGCAGTCAATCAAAAATTCATAAGAGAGGGAAAAATCGTAAAGAAATGCATTCGTTTTACCGGAACAAATTCATTTTG GTGGCCAGTTTTCATTGCAAAAATTCTCTTCACGAGCTTCTAGTCAACACACAAAAACGGGCGACATCAAAGAAGGAAGA GAAGACGCAGAAATACACACGACTTAGAGATGAGCCGGAAAGAAAAAGACGGTCCACCGCATGCAGCACAAAAGTACAAC AGCACGGTCCTCTCAGAAGCGCCACACAAACGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1792834: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17928343321170AI053291TENU1720T. cruzi epimastigote normalized cDNA Library


Date: 14:30:28 on Sat 18 Nov 117.