EST 1792839 is a singleton


Sequence

>1792839 (1 EST) Length=186 TCCTGGTCGTTGCCGTGCCGCCACTGGCCCATCTCGCGGAACCGGCCCGGCCCGCGGCGCCCGTCCAGCAGCTCGACGAC GATGCGGCCCGAAAGCGCTTCAACGACATGCTGAAGTTACCATTGCCAGCGCAGGAATAATCGCTGCCGCCAGATCTGCG TTGCAGCGCGGCATGGCCGTCTGGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1792839: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17928393321175AI053296TENU1725T. cruzi epimastigote normalized cDNA Library


Date: 6:16:20 on Fri 24 Nov 117.