EST 1792848 is a singleton


Sequence

>1792848 (1 EST) Length=198 CTCCATTAGATGCAGCTGCCTTAGATTTAGGTGAAACAGGCAAAGAATTGGGGTCTTCTGCATCACCTTGGTCTTCAGTG GCCTCCTGAGTGTTTCCTGCGTGCACGGACGGGCAGCAGCACAGGGCAAGCACCAACAGGGCGCACAGCAGACGGCACGT CATCATCATCGTGAGTGTGGTCGTTCAGTGGTGTGGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1792848: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17928483321184AI053305TENU1697T. cruzi epimastigote normalized cDNA Library


Date: 21:4:10 on Sun 19 Nov 117.