EST 1797097 is a singleton


Sequence

>1797097 (1 EST) Length=423 TGCCTGGACATACGACGAGGAAGTCGGCTGCATCGGTGGCCAGGTTTTGACAGATTTCCTGCGGGAACACAAAATCAGGG CGGAATGCTGCATTGTTGGTGAGCCAACCTCTAATAAATTGGTTGTCGCACATAAGGGGCTTTAATTGTATCGTGTTTGT GTGCATGGCAAGGCGGTGCATTCTTCCTACGCCCAAACGAAGCAAGGTTGCAATGCTGTCTATTACGCCGCAAAGCTCAT TGTGAAAATAAACGAAATTGCAGAGAACATTAAATTTTATGGTATGCAAGACCCCTGTTTTGACGTTCCCTTTACAACGA TGTCACCAAATTTAATTCAAGGCGGTAATGCCCTAAATACGGTTCCCGCGAAGTGCGAATTTGTCTATGCAATGAGGTAT TTACCGGAGGCCGAAGCTGAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1797097: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17970973331512AI057646TENU1736T. cruzi epimastigote normalized cDNA Library


Date: 17:0:48 on Wed 22 Nov 117.