EST 1797104 is a singleton


Sequence

>1797104 (1 EST) Length=420 CACACGCGCACGACACACACATTGCAGTGCAGGTGGATGCTTCCTTTGTACTCGGTGCTGGCAGTTGCGTGCAGCTGCCG CTTCCTTCCGGGGCGTGAGGGGAAAGGAGGAGAGAGAGTGCGCACCGGAGTCTTTTTTTCTGTTGACGTGATGCACCGCG TGTGACCGTACTGAGTGGGGCGCCGCGTCATGAATGGATAAGGATCCGCCTGCGCGTGTGGCTCTTTGGGCGATTGCTGG CTCTGTGAGCGTTGTGTGTTGTCTGCAGGGCCGTGGCGATATCCTGTTCGCAGCGGGATTCAACTGAAGGCGGAGGCGGT GTGTCTCCTTTTCTCGTCCATTGTGGTTGAATGCGGGCGGTGTGTGCGTTTGTTGTGTGGAGGACCGAATCCTCTCACCC GCGTACTGACGGCACTGCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1797104: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17971043331519AI057653TENU1743T. cruzi epimastigote normalized cDNA Library


Date: 20:58:20 on Sun 19 Nov 117.