EST 1797105 is a singleton


Sequence

>1797105 (1 EST) Length=330 GTGGTGTTTTTATCAGCACGACGATGACGCCTGCACGGTGACAACAGCATAAAATGAATACTAGTAGAAAAGAAGGAAAA GCGGATCGGTGACGGTACTGTTAAGAAGAGAGGGAGAAATATAAATATAAATTTATATTTATAAAGAAGACAAAACGCAT CAACAACAACAACAACATTCCATCTGTTTATTATTATTATTACACGTGTGTTGTATGTACATGTGTGTGTATATGTATGT ATGTATGATATATACATATGCGTATATCATTGTGTTTGTTGAAGGTCTTTCTGTATCGGTGAATGTGAAGAATGCACGTT GTTTGCCACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1797105: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17971053331520AI057654TENU1744T. cruzi epimastigote normalized cDNA Library


Date: 22:15:20 on Fri 17 Nov 117.