EST 1797125 is a singleton


Sequence

>1797125 (1 EST) Length=152 CGTGGATGCAAAGGACGGCAGCGTTTGTGGCCCCGATGGCGGTCTCCCTGACGCGTCCAGGATGCAGGATCACGTGCGGG ATGTCTTTTCACGTCTTGGCTTTAATGATGAAGAAACTGTTGCCTTGATCGGGGCCCACACATGTGGTGAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1797125: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17971253331540AI057674TENU1764T. cruzi epimastigote normalized cDNA Library


Date: 0:40:7 on Fri 24 Nov 117.