EST 1797128 is a singleton


Sequence

>1797128 (1 EST) Length=266 TTCGGGTGGTGGTATTGGTGATGATGTGGAATGAAGGAGGAGGGAGCACCATTTTGTTGATGTTGTTGTTGTCGTTCTGA TTTCCCTCTCTCTCTCTCTCTCTCTCTCTCCATCGTCATTCTGCCCCTTTTGCTTCGTGTGCGTCGCTTCTCCTGCGTGT GGATCCTCAGGAAGGAGGCCATGAAGGAAAAGGGGGTTGCGGCTTTCCAGCTGCAGCAACGTGGCACATATCTTAGGGGA GCGTCTGTGAGGAAAAGGGCGGAGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1797128: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17971283331543AI057677TENU1767T. cruzi epimastigote normalized cDNA Library


Date: 17:25:54 on Wed 22 Nov 117.